MicroRNAs (miRNAs), such as MIR193B, regulate gene expression posttranscriptionally by binding primarily to the 3-prime UTRs of target mRNAs, resulting in mRNA destabilization or translational repression (Leivonen et al., 2011).

Leivonen et al. (2011) reported the mature human MIR193B sequence as AACUGGCCCUCAAAGUCCCGCU.

Sun et al. (2011) reported the mature mouse Mir193b sequence as AACUGGCCCACAAAGUCCCGCU. Database and RT-PCR analyses indicated that Mir193b and Mir365 (MIR365A; 614735), which are located within a 5-kb region of mouse chromosome 16, are cotranscribed. Real-time PCR of 14 mouse tissues showed that Mir193b and Mir365 were highly expressed in brown fat. Mir193b was more weakly expressed in other tissues, including epididymal and subcutaneous white fat. Both Mir193b and Mir365 were highly expressed during adipogenesis in brown adipocyte cultures.

Xu et al. (2011) identified a transcriptional start site upstream of the tandem MIR193B and MIR365A genes. They identified functional binding sites for SP1 (189906) and NF-kappa-B (see 164011) within the common promoter region.

Hartz (2012) mapped the MIR193B gene to chromosome 16p13.12 based on an alignment of the mature MIR193B sequence (AACUGGCCCUCAAAGUCCCGCU) with the genomic sequence (GRCh37).

Xu et al. (2011) showed that the MIR193B and MIR365A genes lie in close proximity on chromosome 16.

Sun et al. (2011) mapped the Mir193b and Mir365a genes within about 5 kb of each other on mouse chromosome 16.

Leivonen et al. (2011) had previously found that MIR193B targeted estrogen receptor-alpha (ESR1; 133430) and inhibited estrogen-induced growth in breast cancer cells. Using proteomics and mass spectrometric analysis, they identified 14-3-3-zeta (YWHAZ; 601288), SHMT2 (138450), and AKR1C2 (600450) as additional major MIR193B targets in MCF-7 human breast cancer cells. Cotransfection experiments confirmed that MIR193B downregulated expression of reporter genes containing the 3-prime UTRs of SHMT2 or YWHAZ or the 5-prime UTR of AKR1C2. Neutralization of MIR193B with anti-MIR193B led to elevated SHMT2 and AKR1C2 protein levels, with lesser upregulation of YWHAZ protein. Specific combinations of knockdowns of these target genes via small interfering RNAs inhibited growth in MCF-7 cells. Leivonen et al. (2011) noted that these MIR193B target genes are involved in cell signaling and steroid hormone production, and they concluded that MIR193B has multiple roles in inhibiting steroid-dependent growth in breast cancer cells.

Using real-time PCR, Sun et al. (2011) found that expression of Mir193b and Mir365 was significantly upregulated upon differentiation in stromal vascular cells cultured from mouse interscapular brown fat and in brown preadipocytes. When introduced during induction of brown fat differentiation, antagomirs targeting Mir193a (614733), Mir193b, or Mir365 reduced lipid accumulation and expression of adipogenic markers in cultured cells. However, knockdown of these miRNAs after differentiation had little effect. Expression of Mir193a, Mir193b, or Mir365 inhibited differentiation of mouse C2C12 myoblasts into multinucleated myotubes. Chromatin immunoprecipitation analysis revealed that the brown fat-specific transcription factor Ppar-alpha (PPARA; 170998) directly bound the promoter region of Mir193b-Mir365. Sun et al. (2011) concluded that Mir193b-Mir365 serves as an essential regulator for brown fat differentiation, in part by repressing myogenesis.