Carbon-500M GGUF

Running with llama.cpp

Carbon is a base DNA model (not instruction-tuned). Use the raw completion front-end so llama.cpp does not apply any chat templating:

llama-completion \
 -hf HuggingFaceBio/Carbon-500M-GGUF:Q8_0 \
 --prompt "<dna>ATGCGCTAGCTACGATCGATCGTAGCTAGCTAGCTAGCTACG" \
 -n 128 --temp 0 --no-display-prompt

If you use llama-cli instead, pass -no-cnv so it does not wrap the prompt in assistant-style markers (otherwise the model may emit annotation tags such as <protein_coding_region> instead of DNA).

Available files

K-quants are produced with --token-embedding-type Q8_0 --output-tensor-type Q8_0 so the sensitive embedding/output tensors stay at Q8_0 precision (important for this model's tight DNA-vs-text logit margins).

Requires a recent llama.cpp

HybridDNATokenizer support was merged in ggml-org/llama.cpp#23410, so any build from master after that works:

git clone https://github.com/ggml-org/llama.cpp
cd llama.cpp && cmake -B build && cmake --build build -j

Usage

Download

hf download HuggingFaceBio/Carbon-500M-GGUF carbon-500m-bf16.gguf --local-dir .

Basic DNA completion

./build/bin/llama-completion -m carbon-500m-bf16.gguf \
 -p '<dna>ATGCGCTAGCTACGATCGATCGTAGCTAGCTAGCTAGCTACG' \
 -n 64 --temp 0 -no-cnv

As a draft model for speculative decoding

Carbon-500M shares the HybridDNA vocab with the larger models, so it makes an excellent draft model:

# 8B target + 500M draft -> ~2x speedup at temp=0
./build/bin/llama-speculative \
 -m carbon-8b-bf16.gguf \
 -md carbon-500m-bf16.gguf \
 -p '<dna>ATGCGCTAGCTACGATCGATCGTAGCTAGCTAGCTAGCTACG' \
 -n 256 --temp 0

See also

• Source weights: HuggingFaceBio/Carbon-500M
• Other GGUF variants: 500M · 3B · 8B

License

Apache-2.0, inherited from the source model.

Base model

HuggingFaceBio/Carbon-500M

(3)

Carbon 500M, 3B, 8B genomic models and GGUF variants for llama.cpp • 7 items • Updated 15 days ago • 43