VOOZH about

URL: https://huggingface.co/multimolecule/rnafm

⇱ multimolecule/rnafm · Hugging Face


RNA-FM

Pre-trained model on non-coding RNA (ncRNA) using a masked language modeling (MLM) objective.

Disclaimer

This is an UNOFFICIAL implementation of the Interpretable RNA Foundation Model from Unannotated Data for Highly Accurate RNA Structure and Function Predictions by Jiayang Chen, Zhihang Hu, Siqi Sun, et al.

The OFFICIAL repository of RNA-FM is at ml4bio/RNA-FM.

The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.

The team releasing RNA-FM did not write this model card for this model so this model card has been written by the MultiMolecule team.

Model Details

RNA-FM is a bert-style model pre-trained on a large corpus of non-coding RNA sequences in a self-supervised fashion. This means that the model was trained on the raw nucleotides of RNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the Training Details section for more information on the training process.

Variants

Model Specification

Variants Num Layers Hidden Size Num Heads Intermediate Size Num Parameters (M) FLOPs (G) MACs (G) Max Num Tokens
mRNA-FM 12 1280 20 5120 239.26 258.08 128.85 1024
RNA-FM 640 99.52 109.02 54.36

Links

Usage

The model file depends on the multimolecule library. You can install it using pip:

pip install multimolecule

Direct Use

Masked Language Modeling

You can use this model directly with a pipeline for masked language modeling:

import multimolecule # you must import multimolecule to register models
from transformers import pipeline

predictor = pipeline("fill-mask", model="multimolecule/rnafm")
output = predictor("gguc<mask>cucugguuagaccagaucugagccu")

Downstream Use

Extract Features

Here is how to use this model to get the features of a given sequence in PyTorch:

from multimolecule import RnaTokenizer, RnaFmModel


tokenizer = RnaTokenizer.from_pretrained("multimolecule/rnafm")
model = RnaFmModel.from_pretrained("multimolecule/rnafm")

text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")

output = model(**input)

Sequence Classification / Regression

This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression.

Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch:

import torch
from multimolecule import RnaTokenizer, RnaFmForSequencePrediction


tokenizer = RnaTokenizer.from_pretrained("multimolecule/rnafm")
model = RnaFmForSequencePrediction.from_pretrained("multimolecule/rnafm")

text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
label = torch.tensor([1])

output = model(**input, labels=label)

Token Classification / Regression

This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for token classification or regression.

Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch:

import torch
from multimolecule import RnaTokenizer, RnaFmForTokenPrediction


tokenizer = RnaTokenizer.from_pretrained("multimolecule/rnafm")
model = RnaFmForTokenPrediction.from_pretrained("multimolecule/rnafm")

text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
label = torch.randint(2, (len(text), ))

output = model(**input, labels=label)

Contact Classification / Regression

This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression.

Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch:

import torch
from multimolecule import RnaTokenizer, RnaFmForContactPrediction


tokenizer = RnaTokenizer.from_pretrained("multimolecule/rnafm")
model = RnaFmForContactPrediction.from_pretrained("multimolecule/rnafm")

text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
label = torch.randint(2, (len(text), len(text)))

output = model(**input, labels=label)

Training Details

RNA-FM used Masked Language Modeling (MLM) as the pre-training objective: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling.

Training Data

The RNA-FM model was pre-trained on RNAcentral. RNAcentral is a free, public resource that offers integrated access to a comprehensive and up-to-date set of non-coding RNA sequences provided by a collaborating group of Expert Databases representing a broad range of organisms and RNA types.

RNA-FM applied CD-HIT (CD-HIT-EST) with a cut-off at 100% sequence identity to remove redundancy from the RNAcentral. The final dataset contains 23.7 million non-redundant RNA sequences.

RNA-FM preprocessed all tokens by replacing "U"s with "T"s.

Note that during model conversions, "T" is replaced with "U". [RnaTokenizer][multimolecule.RnaTokenizer] will convert "T"s to "U"s for you, you may disable this behaviour by passing replace_T_with_U=False.

Training Procedure

Preprocessing

RNA-FM used masked language modeling (MLM) as the pre-training objective. The masking procedure is similar to the one used in BERT:

  • Mask rate: 15%
  • Replacement: <mask> for 80% of masked tokens
  • Replacement: random token for 10% of masked tokens
  • Replacement: unchanged token for 10% of masked tokens

Pre-training

The model was trained on 8 NVIDIA A100 GPUs with 80GiB memories.

  • Learning rate: 1e-4
  • Learning rate scheduler: Inverse square root
  • Learning rate warm-up: 10,000 steps
  • Weight decay: 0.01

Citation

@article{chen2022interpretable,
 title={Interpretable rna foundation model from unannotated data for highly accurate rna structure and function predictions},
 author={Chen, Jiayang and Hu, Zhihang and Sun, Siqi and Tan, Qingxiong and Wang, Yixuan and Yu, Qinze and Zong, Licheng and Hong, Liang and Xiao, Jin and King, Irwin and others},
 journal={arXiv preprint arXiv:2204.00300},
 year={2022}
}

The artifacts distributed in this repository are part of the MultiMolecule project. If MultiMolecule supports your research, please cite the MultiMolecule project as follows:

@software{chen_2024_12638419,
 author = {Chen, Zhiyuan and Zhu, Sophia Y.},
 title = {MultiMolecule},
 doi = {10.5281/zenodo.12638419},
 publisher = {Zenodo},
 url = {https://doi.org/10.5281/zenodo.12638419},
 year = 2024,
 month = may,
 day = 4
}

Contact

Please use GitHub issues of MultiMolecule for any questions or comments on the model card.

Please contact the authors of the RNA-FM paper for questions or comments on the paper/model.

License

This model implementation is licensed under the GNU Affero General Public License.

For additional terms and clarifications, please refer to our License FAQ.

SPDX-License-Identifier: AGPL-3.0-or-later
Downloads last month
50,409
Safetensors
Model size
99.5M params
Tensor type
F32
·

Model tree for multimolecule/rnafm

Finetunes
1 model

Dataset used to train multimolecule/rnafm

Paper for multimolecule/rnafm